| |
Abstract
A
polymorphic biomarker gene with a nucleotide sequence of 245 bps was
isolated from normal human mammary epithelial cells (MCF-10A) by using
the DNA amplification fingerprinting (DAF) technique. This marker was
absent in human breast cancer cells (MCF-7). A Genbank database search
with this gene sequence revealed it had 100% homology with the
nucleotide sequence of human chromosome 4 (BAC RP11-451F20) (bps
1613220-161564) (Genbank account: AC093844.3). The nucleotide sequence
of the biomarker was translated using Genbank CDS (account gi |11387274
|sp |P55782| PPNK_BUCAI), and revealed that this gene codes for a
probable inorganic polyphosphate/ATP-NAD kinase. In order to evaluate
the effects that the 245 bps biomarker would have on the morphology of
MCF-7 cells, the MCF-7 cells were transfected with the 245 bps
biomarker. There were observable changes in the morphology of the
transfected cells. These changes included an increase in cell
elongation and a decrease in cell aggregation.
Significance
The identification of genetic biomarkers in breast cancer cells is of
great value in oncology. The absence or presence of a genetic sequence
may prove to be the distinguishing factor in the onset of cancerous
phenomena of the cell. This study has identified a genetic biomarker
that distinguishes the normal mammary cell from the cancerous cell. The
nucleotide sequence of this gene can be used in the development of
immunogenic peptides needed for cancer preventative treatments, as
addressed in the discussion section. Our results show that the
replacement of the genetic sequence that is absent in cancer cells can
alter their proliferation and differentiation. It is our hope that
these results may lead to a better understanding of the nature of this
type of tumor and may lead to more effective ways to treat cancer
related illnesses.
Introduction
DNA
‘fingerprinting’ has been used for genome linkage, genetic variation,
population and pedigree analysis, forensic identification, localization
of disease loci, and epidermology (Watkins, 1988, Donis-Keller et al.,
1987, Landegren et al., 1988). Variation in the nucleotide sequence of
DNA has been exploited to produce characteristic fingerprinting because
of its plasticity, ubiquity, and stability (Caetano-Anollés et al.,
1991, Golenburg et al., 1990, Hagelberg et al., 1991). Cancer cells
typically possess hundreds and even thousands of genomic errors, and
unique patterns of genetic mutations are found in virtually every
different tumor (Kerangueven et al., 1997, Jiang et al., 2000). Unlike
classical genetic diseases, there are no well-defined correspondences
between the genetic mutations present in cancer populations and the
cellular characteristics of the malignant phenotype (Gatenby and Frieden,
2002).
The most
common form of cancer among women is breast cancer (Spencer et al.,
2001, Edwards et al. 2005, Schwartz et al., 2000). Although it is the
second leading cause of mortality among females, the pathogenesis of the
disease remains unclear (Kuller, 1995, Ernstar et al., 1996). Most
mutations in human malignancies were identified by conventional methods
such as single-strand conformational polymorphism (SSCP) and DNA
sequencing (Wen et al., 2000). Other methods, such as denaturing
gradient gel electrophoresis, heteroduplex analysis, and cleavage
methods (Cotton, 1997), have also been used. All these methods are
relatively time-consuming, labor intensive, and sequential processes.
The
amplification fragment length polymorphism (AFLP) involves the enzymatic
amplification of template DNA directed by one or more arbitrary
oligonucleotide primers to produce a characteristics spectrum of
products, a portion of which could be polymorphic. The procedure is
fast, independent of prior genetic and biochemical knowledge of the
organism tested, and allows tailoring of the number of products and
polymorphisms generated (Bassam et al., 1991). The DNA amplification
fingerprinting (DAF) technique is one of the best technological
developments due to its use of the simplest and most relaxed
amplification conditions, the shortest primers, and offering high
resolution. DAF is based on the principle that DNA from two different
sources has different distributions of specific DNA sites. The DNA at
these sites can be cut with restriction nucleases producing a unique set
of DNA fragments from the entire genome of the organism. The DAF
technique can be accomplished by sorting these by size using
SDS-polyacrylamide gel electrophoresis (Caetano-Anollés et al., 1991).
Breast cancer
and other malignancies result from step-wise genetic alternations of
normal host cells. Genome instability promotes great potential to
develop genetic changes such as gene loss, gene amplification, point
mutation, and chromosomal translocations (Osborne et al., 2004). In
regards to breast cancer, loss of heterozygosity (gene loss) and changes
in gene copy number cause the development and progression the disease
(Waldman et al., 2000, O’ Connell et al., 1998). In the present
investigation, we used the DAF technique in the identification of the
polymorphism of the human mammary epithelial cell line (MCF-10A). As a
result, our laboratory was able to isolate and sequence a 245 bps
polymorphic biomarker that was present in MCF-10A cells, but absent in
the DNA fingerprint profile of MCF-7 cells. This project demonstrates
the ease and utility of DAF for the differentiation and relation of
various differences between the genomes of MCF-7 and MCF-10A cells.
Methods
Isolation
of genomic DNA
Genomic DNA of human mammary epithelial cells (MCF-10A) and breast
cancer cells (MCF-7) was isolated by DNAzol® Genomic DNA isolation
reagent (Molecular Research Center, Inc., Cincinnati, OH).
Isolation of genomic DNA and generation of fingerprinting profile
DNA
amplification was performed in a solution with total volume of 25 µl
containing 2 ng of template DNA, 0.3 µl of DAF primer (shorter arbitrary
primer, 9–10 nucleotides in length, and low stringency cycles to amplify
DNA polymorphism (Williams et al., 1990)), 0.3 units/µl of Amplitag DNA
polymerase (Stoffel fragment) from Thermus aquaticus (Perkin-Elmer/cetus,
Norwalk, Conn., USA), 200µM (each of the four) deoxynucleotide
triphosphates (Pharmacia LKB Biotechnology Inc. Piscataway, N.J.), 6 mM
MgCl2, 10 mM Tris-HCl (pH 8.3), and 10 mM KCl. The solution also
contained 0.3 µl of DAF arbitrary primer (8-10 nucleotides in length)
that had required low stringency cycles to amplify DNA polymorphism
(Williams et. al., 1990). Due to the fact that there was no known
evidence of which primers would yield polymorphic products, 10 DAF
primers from each of the 4 series (A, B, C, and D; totaling forty
primers) were randomly selected and used for both MCF-10A and MCF-7 cell
lines.
Out of these 40 DAF primers, only one (A25 (GCCCGTGC)) yielded
polymorphic markers in three separate experiments, giving evidence of
reproducible results. The remaining 39 DAF primers did not yield any
polymorphisms. The solution was overloaded with two drops of mineral
oil. Samples were amplified in an Ericomp thermocycler (Ericomp Inc. San
Diego, Calif.) for 35 two-step cycles of 1 s at 960C and 1 s at 300C.
The heating and cooling rates of the thermocycler were 230C/min. and
140C/min., respectively. Three µl of the amplification reaction was
loaded with 3 µl of loading buffer (5M urea, 3% ficoll, 0.12% Tris,
1.12% EDTA, 0.02% xylene cyanol and 0.02% bromophenol blue).
Polyacrylamide gel electrophoresis (Caetano-Anollés et al., 1991; Bassam
et. al. 1991) was used to separate DNA amplification fragments.
Electrophoresis was run at 100 V, until the dye front was approximately
1 cm from the end of the gel. DNA was visualized using a fast and
sensitive silver staining procedure that detects 1 pg DNA/mm2 band
cross-section (Bassam et al., 1991). Polyester-backed gels were
preserved for permanent record by soaking in 50% ethanol for 10 min. and
drying at room temperature.
Extraction
and cloning of polymorphic biomarker
The
polymorphic band (Figure 1) was excised from the wet polyacrylamide gel
and submerged in 20 µl of TE buffer (10mM Tris, 1 mM EDTA). The mixture
was heated for 20 min. at 90oC and stored at 4oC for 2 days. 2 µl of the
mixture was used for the DAF PCR reaction with DAF arbitrary primer
(A25). Three µl of the PCR product was ligated into pCR®II and
transformed into one-shot competent cells (according to the procedure of
TA cloning kit Dual Promoter (pCR®II), Invitrogen, Life Technology –
Version H). Individual white colonies of polymorphic band were digested
by EcoR1 restriction enzyme and run on a 1% agarose gel stained with
ethidium bromide (0.5 ug/ml). The gel was viewed under UV light to
identify the bands that contained the fragment. The expected colonies
were grown in LB medium (1% tryptone, 0.5% yeast extract, 1% NaCl,
ampicillin antibiotic (50 µg/ml) (pH 7.0)) over night shaking at 37oC.
Purification
and sequencing of polymorphic biomarker
The plasmid
DNA was purified by Wizard™ Plus Miniprep DNA purification system (Promega
Corporation). The purified plasmid DNA was sequenced by a DNA sequencer
(ABI Prism, Model 3100, Version 3.7) at Morehouse School of Medicine in
Atlanta, Georgia, USA.
Transfection
of MCF-7 cells
Two µg of the
isolated 245 bps DNA fragment was added to 100 µl of OPTI-MEM medium.
This mixture was combined with 10 µl of CELLFECTIN reagent in 100 µl
OPTI-MEM medium. The combined mixture was gently mixed and incubated at
room temperature for 30 min. The incubated mixture was carefully
overlaid on the MCF-7 cells (2-3 × 105 cells in 4 ml of growth medium
supplemented with serum) and incubated for 24 h in a 5 % CO2 incubator
(Wood, 1991). To each tube containg CELLFECTIN reagent – DNA complexes,
1.8 ml serum-free growth medium was added, mixed gently, and overlaid
onto cells. The cells were incubated for 24 h at 370C in a 5 %
CO2 incubator. The DNA-containing medium was replaced with 4 ml of
growth medium (supplemented with serum) and the cells were incubated at
37 0C in a 5 % CO2 incubator for another 48 h. The cells were
trypsinized and the genomic DNA of the transfected MCF-7, untransfected
MCF-7 (control), and MCF-10A (control) cells were isolated by DNAzol
genomic DNA isolation reagent. DNA amplification fingerprinting was
performed as mentioned earlier and the cell counts were performed using
an Axiovert-25 inverted microscope (Software: Axiovision 4.0).
Results
Identification of polymorphic biomarker
A polymorphic
biomarker of 245 bps was found in normal human mammary epithelial cell
line, MCF-10A (Figure 1). As compared to the DNA amplification
fingerprint of human breast cancer cell line, MCF-7, this gene was
absent. Although there were other biomarker genes present, this study
focuses only on the 245 bps biomarker. The other biomarkers will be
subjected to further studies which may include extracting them,
obtaining their nucleotide sequences, and transfecting them into MCF-7
cells.

Figure 1. DNA
amplification fingerprint of breast cancer cell (MCF-7) and human
mammary epithelial cell (MCF-10A). 3 µl of the DAF PCR amplification
reaction mixture was loaded with 3 µl of loading buffer. Electrophoresis
was continued at 100V until the dye front was approximately 1 cm from
the end of the gel. The amplification fragments were separated by
polyacrylamide gel (5%) electrophoresis. DNA was visualized using a fast
and sensitive silver staining procedure that detects 1 pg DNA/mm band
cross-section. The polymorphic marker was found at 245 bps using the
molecular weight marker (MM). Polymorphic biomarker sequence The biomarker was extracted from the
wet DAF polyacrylamide gel and cloned into the pCR®II vector to obtain a
sufficient quantity of DNA for nucleotide sequencing. We digested the
ligated vector pCR®II using EcoR1 to confirm our expected marker. The
nucleotide sequence of this biomarker is:
| |
ATTATGAGAGATTGCTGAGGATTTAGAAAACACTTACACTTTTGATTTTGTAAACTAAGGCTTGT
AAACCAAAGCTCTGCCCAACTTTGGGTTCTCTCAGCAGAGCATCAAAATAAGATGAAAGAAC
TGGAGTGAGTGAACTGTAGAAAAACTGACAGCATCCAGTTGAGGGCGAGACATCACCGCACGGGC |
|
|
Polymorphic biomarker analysis
The Genbank database (account: AC093844.3) was used to analyze the
biomarker
sequence. It was revealed that it significantly aligned with the
nucleotide sequence of human chromosome 4 (BAC RP11-451F20) (bps
161322-161564) with 100% homology. The Genbank CDS (account: (gi
|11387274 |sp |P55782| PPNK_BUCAI) revealed that this biomarker codes
for probable inorganic polyphosphate/ATP-NAD kinase.
Transfection of MCF-7 cells
In order to evaluate the effects that the 245 bps biomarker would have
on the morphology of MCF-7 cells, the MCF-7 cells were transfected with
the 245 bps biomarker. There were observable changes in the morphology
of the transfected cells. For example, the transfected cells were more
elongated and less aggregated (Figure 2).

Figure 2.
Cell morphology of MCF-7 cells transfected with the 245 bps polymorphic
biomarker gene. MCF-7 cells were transfected with the 245 bps
polymorphic marker gene using CELLFECTIN reagent-DNA complexes. The
cells were incubated for 24 h at 37°C in a 5% CO2 incubator. The
DNA-containing medium was replaced with 4 ml of growth medium
(supplemented with serum) and the cells were incubated (37°C) in a 5 %
CO2 incubator for 48 h. The cells were trypsinized, and the genomic DNA
was isolated by DNAzol Genomic DNA isolation reagent. Visualization of
the cells was performed using an Axiovert-25 inverted microscope
(Software: Axiovision 4.0).
Discussion
A polymorphic biomarker (245 bps) in the genomic nucleotide sequence
of human mammary epithelial cell line, MCF-10A, was found to be absent
from the genome of breast cancer cell line, MCF-7. This was evident upon
comparing the DNA fingerprints of MCF-10A and MCF-7. The deficiency of
this gene may be responsible for the abnormal proliferation and
differentiation in MCF-7 cells. The Genbank database analysis of the
identified biomarker indicated that it has significant alignment (100%
homology) with the nucleotide sequence of human chromosome 4 (BAC
RP11-451F20) (bps 161322-161564)(Genbank account: AC093844.3). The
nucleotide sequence of this biomarker was translated into an amino acid
sequence using Genbank CDS (account gi |11387274 |sp |P55782| PPNK_BUCAI).
It was revealed that this gene codes for a probable inorganic
polyphosphate/ATP-NAD kinase. We suspect that lack of this protein in
MCF-7 cells may contribute to tumorgenesis in human breast cells.
Reports have revealed that there may be multiple putative tumor
suppressor genes located on both arms of chromosome 4, whose
inactivation is important in the pathogenesis of breast cancer (Shivapurkar
et al., 1999). Approximately 70% of tumors show genomic amplification of
HER2/neu, which correlated with recurring loss of mouse chromosome 4
D-E. It is likely that this region contains putative tumor suppressor
genes whose inactivation is required for tumor formation in this model
of human breast cancer (Montagena et al., 2002).
Recent results manifest
the frequent alterations of chromosome 4 in BRCA-1 associated breast
tumors and signify the location of several genes of potential importance
in breast cancer (Johnnsdottir et al., 2004). The deletion of the 245
bps gene from chromosome 4 may be the source of abnormalities in
cellular function that lead to tumorgenesis. We were curious as to the
effects that the 245 bps biomarker would have when transfected into the
genome of MCF-7 cells. The transfection experiment resulted in increased
elongation and less aggregation of the MCF-7 cells. It is most likely
that the insertion of the 245 bps gene may have silenced some of the
genes responsible for tumorgenesis in MCF-7 cells.
Based on these findings, we anticipate that the transfection of this
gene present in normal breast cells, but absent in the breast cancer
cells, may not only provide therapeutics for the prevention and cure of
breast cancer, but may also open up a whole new era of investigation of
breast cancer. Our future studies will include gene knockout experiments
that will demonstrate the impact that the absence or alteration of this
biomarker will have on normal human mammary epithelial cells.
Acknowledgements
This work was supported by NIH/NHLBI Grant # KO1HL03835, MBRS/RISE Grant
R25GM60414 and P20CA91366.
References
Bassam, B.J., Caetano-Anollés, G., Gresshoff, P.M. (1991). Fast and
sensitive silver staining of DNA in polyacrylamide gels. Anal.
Biochem. 80, 81-84.
Caetano-Anollés, G., Bassam, B.J., and Gresshoff, P.M. (1991). DNA
amplification fingerprinting using very short arbitrary oligonucleotide
primers. Biotechnology 9, 553-557.
Cotton, R. (1997). Slowly but surely towards better scanning for
mutations. Trends Genet 13, 43-46.
Donis-Keller,
H., Green, P., Helms, C., Cartinhour, S., Weiffenbach, B., Stephens,
K., Keith, T.P., Bowden, D.W., Smith, D.R., Lander, E.S., et al.
(1987). A genetic linkage map of the human genome. Cell 51,
319–337.
Edwards,
B.K., Brown, M.L., Wingo, P.A., Howe, H.L., Ward, E., Ries, L.A.G.,
Schrag, D., et al. (2005). Annual report to the nation on the status
of cancer, 1975-2002, featuring population-based trends in cancer
treatment. J. Natl. Cancer Inst. 97, 1407-1427.
Ernster,
V.L., Barclay, J., Kerlikowske, K., Grady, D., and Henderson, C.
(1996). Incidence of and treatment for ductal carcinomia in situ of
the breast. J. Am. Med. Assoc. 275, 913-918.
Gatenby,
R.A. and Frieden, B.R. (2002) Application of information theory and
extreme physical information of carcinogenesis. Cancer Res. 62,
3675-3684.
Golenberg,
E.M., Giannasi, D.E., Clegg, M.T., Smiley, C.J., Durbin, M.,
Henderson, D., and Zurawski, G. (1990). Chloroplast DNA sequence
from a Miocene Magnolia species. Nature 344, 656-658.
Hagelberg,
E., Gray, I.C., and Jeffreys, A.J. (1991). Identification of the
skeletal remains of a murder victim by DNA analysis. Nature 352,
427-429.
Jiang,
F., Desper, R., Papadimitriou, C.H., Schaffer, A.A., Kallioniemi,
O.P., Richter, J., Schrami, P., Sauter, G., Mihatsch, M.J., and Moch,
H. (2000). Construction of evolutionary tree models for renal
carcinoma from comparative genomic hybridization data. Cancer
Res. 60, 6503-9509.
Johnnsdottir, H.K., Johnnesdottir, G., Agnarsson, B.A., Eerola, H.,
Arason, A., Johnnsson, O.T., Heikkila, P., Egilesson, V., Olsson,
H., Borg, A, et al. (2004). Deletions on chromosome 4 in sporadic
and BRCA mutated tumors and association with pathological variables.
Anticancer Research 24(5A), 2681-2687.
Kerangueven, F., Noguchi, T., Coulier, F., Alione, F., Wargniez, V.,
Simony-Lafontaine, J., Longy, M., Jacquemier, J., Sobol, H.,
Eisinger, F., et al. (1997). Genome-wide search for loss of
heterozygosity shows extensive genetic diversity of human breast
carcinomas. Cancer Res. 57, 5469-5474.
Kuller,
L.H. (1995). The etiology of breast cancer from epidermiology to
prevention. Public Health Rev. 23, 157-213.
Landegren,
U., Kaiser, R., Caskey, C.T., and Hood, L. (1988). DNA diagnostics:
Molecular techniques and automation. Science 242, 229-237.
Montagna,
C., Andrechek, E.R., Padilla-Nash, H., Muller, W.J., and Reid, T.
(2002). Centrosome abnormalities, recurring deletions of chromosome
4, and genomic amplification of HER2/neu define mouse mammary gland
adenocarcinomas induced by mutant HER2/neu. Oncogene 21(6),
890-898.
O’Connell, P., Pekkel, V., Puqua, S.A. (1998). Analysis of loss of
heterozygosity in 399-premalignant breast lesions at 15 genetic
loci. J. Natl. Cancer 90, 697-703.
Osborne,
C., Wilson, P., and Tripathy, D. (2004). Oncogenes and tumor
suppressor genes in breast cancer: potential diagnostic and
therapeutic applications. The Oncologist 9, 361-377.
Schwartz,
L.M., Woloshin, S., Sox, H.C., Fischhoff, B., Welch, H.G. (2000). US
women's attitudes to false positive mammography results and
detection of ductal carcinoma in situ: cross sectional survey.
BMJ 320, 1635-1640.
Shivapurkar, N., Sood, S., Wistuba, I.I., Virmani, A.K., Maitra, A.,
Milchgrub, S., Minna, J.D., and Gazdar, A.F. (1999). Multiple
regions of chromosome 4 demonstrating allelic losses in breast
carcinomas. Cancer Res. 59(15), 3576-3580.
Spencer,
V.A., Samuel, S.K. and Davie, J.R. (2001). Altered profiles in
nuclear matrix proteins associated with DNA in situ during
progression of breast cancer cells. Cancer Res. 6, 1362-1366.
Waldman,
F.M., DeVries, S., Chew, K.L. (2000). Chromosomal alterations in
devoted carcinomas in situ and their in situ recurrences. J.
Natl. Cancer 92, 313-320.
Watkins,
P.C. (1988). Restriction Fragment Length Polymorphism (RFLP):
application in human chromosome mapping and genetic disease
research. Biotechniques 6, 310-320.
Wen, W.H.,
Bernstein, L., Lescallett, J., Beazer-Barclay, Y., Sullivan-Halley,
J., White, M., and Press, M.F. (2000). Comparison of TP53 mutations
identified by oligonucleotides microarray and conventional DNA
sequence analysis. Cancer Res. 60, 2716-2722.
Williams,
J.G.K., Kubelik, A.R., Livak, K.J. Rafalske, J.A., and Tingey, S.V.
(1990). DNA polymorphism amplified by arbitrary primers are useful
as genetic markers. Nucleic Acids Res. 18, 6531-6535.
Wood, K.V.
(1990). Current status in bioluminescence and chemiluminescence.
P. Stanley and L. Kricka, eds. (Chichester: John Wiley and Sons),
pg. 543.
|
|
|