Volume 1, Issue 1, 2007    
       
  Possible deletion of a 245 bps polymorphic marker in breast cancer cells (MCF-7)    
       
  AKM A. Hussain, Brian H. Crawford, Nathan M. Jideama
hussain@lycos.com, crawmonk@aol.com, njideama@cau.edu
Clark Atlanta University
   
       
  Abstract
A polymorphic biomarker gene with a nucleotide sequence of 245 bps was isolated from normal human mammary epithelial cells (MCF-10A) by using the DNA amplification fingerprinting (DAF) technique. This marker was absent in human breast cancer cells (MCF-7).  A Genbank database search with this gene sequence revealed it had 100% homology with the nucleotide sequence of human chromosome 4 (BAC RP11-451F20) (bps 1613220-161564) (Genbank account: AC093844.3).  The nucleotide sequence of the biomarker was translated using Genbank CDS (account gi |11387274 |sp |P55782| PPNK_BUCAI), and revealed that this gene codes for a probable inorganic polyphosphate/ATP-NAD kinase. In order to evaluate the effects that the 245 bps biomarker would have on the morphology of MCF-7 cells, the MCF-7 cells were transfected with the 245 bps biomarker.  There were observable changes in the morphology of the transfected cells.  These changes included an increase in cell elongation and a decrease in cell aggregation.

Significance
The identification of genetic biomarkers in breast cancer cells is of great value in oncology.  The absence or presence of a genetic sequence may prove to be the distinguishing factor in the onset of cancerous phenomena of the cell.  This study has identified a genetic biomarker that distinguishes the normal mammary cell from the cancerous cell.  The nucleotide sequence of this gene can be used in the development of immunogenic peptides needed for cancer preventative treatments, as addressed in the discussion section.  Our results show that the replacement of the genetic sequence that is absent in cancer cells can alter their proliferation and differentiation.  It is our hope that these results may lead to a better understanding of the nature of this type of tumor and may lead to more effective ways to treat cancer related illnesses.

Introduction
DNA ‘fingerprinting’ has been used for genome linkage, genetic variation, population and pedigree analysis, forensic identification, localization of disease loci, and epidermology (Watkins, 1988, Donis-Keller et al., 1987, Landegren et al., 1988). Variation in the nucleotide sequence of DNA has been exploited to produce characteristic fingerprinting because of its plasticity, ubiquity, and stability (Caetano-Anollés et al., 1991, Golenburg et al., 1990, Hagelberg et al., 1991).  Cancer cells typically possess hundreds and even thousands of genomic errors, and unique patterns of genetic mutations are found in virtually every different tumor (Kerangueven et al., 1997, Jiang et al., 2000). Unlike classical genetic diseases, there are no well-defined correspondences between the genetic mutations present in cancer populations and the cellular characteristics of the malignant phenotype (Gatenby and Frieden, 2002).  

The most common form of cancer among women is breast cancer (Spencer et al., 2001, Edwards et al. 2005, Schwartz et al., 2000).  Although it is the second leading cause of mortality among females, the pathogenesis of the disease remains unclear (Kuller, 1995, Ernstar et al., 1996).  Most mutations in human malignancies were identified by conventional methods such as single-strand conformational polymorphism (SSCP) and DNA sequencing (Wen et al., 2000). Other methods, such as denaturing gradient gel electrophoresis, heteroduplex analysis, and cleavage methods (Cotton, 1997), have also been used. All these methods are relatively time-consuming, labor intensive, and sequential processes.

The amplification fragment length polymorphism (AFLP) involves the enzymatic amplification of template DNA directed by one or more arbitrary oligonucleotide primers to produce a characteristics spectrum of products, a portion of which could be polymorphic. The procedure is fast, independent of prior genetic and biochemical knowledge of the organism tested, and allows tailoring of the number of products and polymorphisms generated (Bassam et al., 1991). The DNA amplification fingerprinting (DAF) technique is one of the best technological developments due to its use of the simplest and most relaxed amplification conditions, the shortest primers, and offering high resolution. DAF is based on the principle that DNA from two different sources has different distributions of specific DNA sites. The DNA at these sites can be cut with restriction nucleases producing a unique set of DNA fragments from the entire genome of the organism. The DAF technique can be accomplished by sorting these by size using SDS-polyacrylamide gel electrophoresis (Caetano-Anollés et al., 1991).  

Breast cancer and other malignancies result from step-wise genetic alternations of normal host cells.  Genome instability promotes great potential to develop genetic changes such as gene loss, gene amplification, point mutation, and chromosomal translocations (Osborne et al., 2004).  In regards to breast cancer, loss of heterozygosity (gene loss) and changes in gene copy number cause the development and progression the disease (Waldman et al., 2000, O’ Connell et al., 1998).  In the present investigation, we used the DAF technique in the identification of the polymorphism of the human mammary epithelial cell line (MCF-10A). As a result, our laboratory was able to isolate and sequence a 245 bps polymorphic biomarker that was present in MCF-10A cells, but absent in the DNA fingerprint profile of MCF-7 cells. This project demonstrates the ease and utility of DAF for the differentiation and relation of various differences between the genomes of MCF-7 and MCF-10A cells.  

Methods

Isolation of genomic DNA
Genomic DNA of human mammary epithelial cells (MCF-10A) and breast cancer cells (MCF-7) was isolated by DNAzol® Genomic DNA isolation reagent (Molecular Research Center, Inc., Cincinnati, OH).

Isolation of genomic DNA and generation of fingerprinting profile

DNA amplification was performed in a solution with total volume of 25 µl containing 2 ng of template DNA, 0.3 µl of DAF primer (shorter arbitrary primer, 9–10 nucleotides in length, and low stringency cycles to amplify DNA polymorphism (Williams et al., 1990)), 0.3 units/µl of Amplitag DNA polymerase (Stoffel fragment) from Thermus aquaticus (Perkin-Elmer/cetus, Norwalk, Conn., USA), 200µM (each of the four) deoxynucleotide triphosphates (Pharmacia LKB Biotechnology Inc. Piscataway, N.J.), 6 mM MgCl2, 10 mM Tris-HCl (pH 8.3), and 10 mM KCl. The solution also contained 0.3 µl of DAF arbitrary primer (8-10 nucleotides in length) that had required low stringency cycles to amplify DNA polymorphism (Williams et. al., 1990). Due to the fact that there was no known evidence of which primers would yield polymorphic products, 10 DAF primers from each of the 4 series (A, B, C, and D; totaling forty primers) were randomly selected and used for both MCF-10A and MCF-7 cell lines.

Out of these 40 DAF primers, only one (A25 (GCCCGTGC)) yielded polymorphic markers in three separate experiments, giving evidence of reproducible results. The remaining 39 DAF primers did not yield any polymorphisms. The solution was overloaded with two drops of mineral oil. Samples were amplified in an Ericomp thermocycler (Ericomp Inc. San Diego, Calif.) for 35 two-step cycles of 1 s at 960C and 1 s at 300C. The heating and cooling rates of the thermocycler were 230C/min. and 140C/min., respectively. Three µl of the amplification reaction was loaded with 3 µl of loading buffer (5M urea, 3% ficoll, 0.12% Tris, 1.12% EDTA, 0.02% xylene cyanol and 0.02% bromophenol blue). Polyacrylamide gel electrophoresis (Caetano-Anollés et al., 1991; Bassam et. al. 1991) was used to separate DNA amplification fragments. Electrophoresis was run at 100 V, until the dye front was approximately 1 cm from the end of the gel. DNA was visualized using a fast and sensitive silver staining procedure that detects 1 pg DNA/mm2 band cross-section (Bassam et al., 1991). Polyester-backed gels were preserved for permanent record by soaking in 50% ethanol for 10 min. and drying at room temperature.

Extraction and cloning of polymorphic biomarker

The polymorphic band (Figure 1) was excised from the wet polyacrylamide gel and submerged in 20 µl of TE buffer (10mM Tris, 1 mM EDTA). The mixture was heated for 20 min. at 90oC and stored at 4oC for 2 days. 2 µl of the mixture was used for the DAF PCR reaction with DAF arbitrary primer (A25). Three µl of the PCR product was ligated into pCR®II and transformed into one-shot competent cells (according to the procedure of TA cloning kit Dual Promoter (pCR®II), Invitrogen, Life Technology – Version H). Individual white colonies of polymorphic band were digested by EcoR1 restriction enzyme and run on a 1% agarose gel stained with ethidium bromide (0.5 ug/ml).  The gel was viewed under UV light to identify the bands that contained the fragment.  The expected colonies were grown in LB medium (1% tryptone, 0.5% yeast extract, 1% NaCl, ampicillin antibiotic (50 µg/ml) (pH 7.0)) over night shaking at 37oC.  

Purification and sequencing of polymorphic biomarker

The plasmid DNA was purified by Wizard™ Plus Miniprep DNA purification system (Promega Corporation). The purified plasmid DNA was sequenced by a DNA sequencer (ABI Prism, Model 3100, Version 3.7) at Morehouse School of Medicine in Atlanta, Georgia, USA.

Transfection of MCF-7 cells

Two µg of the isolated 245 bps DNA fragment was added to 100 µl of OPTI-MEM medium.  This mixture was combined with 10 µl of CELLFECTIN reagent in 100 µl OPTI-MEM medium. The combined mixture was gently mixed and incubated at room temperature for 30 min. The incubated mixture was carefully overlaid on the MCF-7 cells (2-3 × 105 cells in 4 ml of growth medium supplemented with serum) and incubated for 24 h in a 5 % CO2 incubator (Wood, 1991). To each tube containg CELLFECTIN reagent – DNA complexes, 1.8 ml serum-free growth medium was added, mixed gently, and overlaid onto cells. The cells were incubated for 24 h at 370C in a 5 % CO2 incubator. The DNA-containing medium was replaced with 4 ml of growth medium (supplemented with serum) and the cells were incubated at 37 0C in a 5 % CO2 incubator for another 48 h. The cells were trypsinized and the genomic DNA of the transfected MCF-7, untransfected MCF-7 (control), and MCF-10A (control) cells were isolated by DNAzol genomic DNA isolation reagent. DNA amplification fingerprinting was performed as mentioned earlier and the cell counts were performed using an Axiovert-25 inverted microscope (Software: Axiovision 4.0).

Results

Identification of polymorphic biomarker   

A polymorphic biomarker of 245 bps was found in normal human mammary epithelial cell line, MCF-10A (Figure 1).  As compared to the DNA amplification fingerprint of human breast cancer cell line, MCF-7, this gene was absent.  Although there were other biomarker genes present, this study focuses only on the 245 bps biomarker.  The other biomarkers will be subjected to further studies which may include extracting them, obtaining their nucleotide sequences, and transfecting them into MCF-7 cells.



Figure 1. DNA amplification fingerprint of breast cancer cell (MCF-7) and human mammary epithelial cell (MCF-10A). 3 µl of the DAF PCR amplification reaction mixture was loaded with 3 µl of loading buffer. Electrophoresis was continued at 100V until the dye front was approximately 1 cm from the end of the gel. The amplification fragments were separated by polyacrylamide gel (5%) electrophoresis. DNA was visualized using a fast and sensitive silver staining procedure that detects 1 pg DNA/mm band cross-section. The polymorphic marker was found at 245 bps using the molecular weight marker (MM). Polymorphic biomarker sequence The biomarker was extracted from the wet DAF polyacrylamide gel and cloned into the pCR®II vector to obtain a sufficient quantity of DNA for nucleotide sequencing. We digested the ligated vector pCR®II using EcoR1 to confirm our expected marker. The nucleotide sequence of this biomarker is:
 

 
ATTATGAGAGATTGCTGAGGATTTAGAAAACACTTACACTTTTGATTTTGTAAACTAAGGCTTGT
AAACCAAAGCTCTGCCCAACTTTGGGTTCTCTCAGCAGAGCATCAAAATAAGATGAAAGAAC

TGGAGTGAGTGAACTGTAGAAAAACTGACAGCATCCAGTTGAGGGCGAGACATCACCGCACGGGC
 

Polymorphic biomarker analysis
The Genbank database (account: AC093844.3) was used to analyze the biomarker
sequence. It was revealed that it significantly aligned with the nucleotide sequence of human chromosome 4 (BAC RP11-451F20) (bps 161322-161564) with 100% homology. The Genbank CDS (account: (gi |11387274 |sp |P55782| PPNK_BUCAI) revealed that this biomarker codes for probable inorganic polyphosphate/ATP-NAD kinase.

Transfection of MCF-7 cells
In order to evaluate the effects that the 245 bps biomarker would have on the morphology of MCF-7 cells, the MCF-7 cells were transfected with the 245 bps biomarker. There were observable changes in the morphology of the transfected cells. For example, the transfected cells were more elongated and less aggregated (Figure 2).



Figure 2. Cell morphology of MCF-7 cells transfected with the 245 bps polymorphic biomarker gene. MCF-7 cells were transfected with the 245 bps polymorphic marker gene using CELLFECTIN reagent-DNA complexes. The cells were incubated for 24 h at 37°C in a 5% CO2 incubator. The DNA-containing medium was replaced with 4 ml of growth medium (supplemented with serum) and the cells were incubated (37°C) in a 5 % CO2 incubator for 48 h. The cells were trypsinized, and the genomic DNA was isolated by DNAzol Genomic DNA isolation reagent. Visualization of the cells was performed using an Axiovert-25 inverted microscope (Software: Axiovision 4.0).

Discussion
A polymorphic biomarker (245 bps) in the genomic nucleotide sequence of human mammary epithelial cell line, MCF-10A, was found to be absent from the genome of breast cancer cell line, MCF-7. This was evident upon comparing the DNA fingerprints of MCF-10A and MCF-7. The deficiency of this gene may be responsible for the abnormal proliferation and differentiation in MCF-7 cells. The Genbank database analysis of the identified biomarker indicated that it has significant alignment (100% homology) with the nucleotide sequence of human chromosome 4 (BAC RP11-451F20) (bps 161322-161564)(Genbank account: AC093844.3). The nucleotide sequence of this biomarker was translated into an amino acid sequence using Genbank CDS (account gi |11387274 |sp |P55782| PPNK_BUCAI).

It was revealed that this gene codes for a probable inorganic polyphosphate/ATP-NAD kinase. We suspect that lack of this protein in MCF-7 cells may contribute to tumorgenesis in human breast cells. Reports have revealed that there may be multiple putative tumor suppressor genes located on both arms of chromosome 4, whose inactivation is important in the pathogenesis of breast cancer (Shivapurkar et al., 1999). Approximately 70% of tumors show genomic amplification of HER2/neu, which correlated with recurring loss of mouse chromosome 4 D-E. It is likely that this region contains putative tumor suppressor genes whose inactivation is required for tumor formation in this model of human breast cancer (Montagena et al., 2002).

Recent results manifest the frequent alterations of chromosome 4 in BRCA-1 associated breast tumors and signify the location of several genes of potential importance in breast cancer (Johnnsdottir et al., 2004). The deletion of the 245 bps gene from chromosome 4 may be the source of abnormalities in cellular function that lead to tumorgenesis. We were curious as to the effects that the 245 bps biomarker would have when transfected into the genome of MCF-7 cells. The transfection experiment resulted in increased elongation and less aggregation of the MCF-7 cells. It is most likely that the insertion of the 245 bps gene may have silenced some of the genes responsible for tumorgenesis in MCF-7 cells.

Based on these findings, we anticipate that the transfection of this gene present in normal breast cells, but absent in the breast cancer cells, may not only provide therapeutics for the prevention and cure of breast cancer, but may also open up a whole new era of investigation of breast cancer. Our future studies will include gene knockout experiments that will demonstrate the impact that the absence or alteration of this biomarker will have on normal human mammary epithelial cells.

Acknowledgements
This work was supported by NIH/NHLBI Grant # KO1HL03835, MBRS/RISE Grant R25GM60414 and P20CA91366.

References

Bassam, B.J., Caetano-Anollés, G., Gresshoff, P.M. (1991). Fast and sensitive silver staining of DNA in polyacrylamide gels. Anal. Biochem. 80, 81-84.

Caetano-Anollés, G., Bassam, B.J., and Gresshoff, P.M. (1991). DNA amplification fingerprinting using very short arbitrary oligonucleotide primers. Biotechnology 9, 553-557.

Cotton, R. (1997). Slowly but surely towards better scanning for mutations. Trends Genet 13, 43-46.

Donis-Keller, H., Green, P., Helms, C., Cartinhour, S., Weiffenbach, B., Stephens, K., Keith, T.P., Bowden, D.W., Smith, D.R., Lander, E.S., et al. (1987). A genetic linkage map of the human genome. Cell 51, 319–337.

Edwards, B.K., Brown, M.L., Wingo, P.A., Howe, H.L., Ward, E., Ries, L.A.G., Schrag, D., et al. (2005). Annual report to the nation on the status of cancer, 1975-2002, featuring population-based trends in cancer treatment. J. Natl. Cancer Inst. 97, 1407-1427.

Ernster, V.L., Barclay, J., Kerlikowske, K., Grady, D., and Henderson, C. (1996). Incidence of and treatment for ductal carcinomia in situ of the breast. J. Am. Med. Assoc. 275, 913-918.

Gatenby, R.A. and Frieden, B.R. (2002) Application of information theory and extreme physical information of carcinogenesis. Cancer Res. 62, 3675-3684.

Golenberg, E.M., Giannasi, D.E., Clegg, M.T., Smiley, C.J., Durbin, M., Henderson, D., and Zurawski, G. (1990). Chloroplast DNA sequence from a Miocene Magnolia species. Nature 344, 656-658.

Hagelberg, E., Gray, I.C., and Jeffreys, A.J. (1991). Identification of the skeletal remains of a murder victim by DNA analysis. Nature 352, 427-429.

Jiang, F., Desper, R., Papadimitriou, C.H., Schaffer, A.A., Kallioniemi, O.P., Richter, J., Schrami, P., Sauter, G., Mihatsch, M.J., and Moch, H. (2000). Construction of evolutionary tree models for renal carcinoma from comparative genomic hybridization data. Cancer Res. 60, 6503-9509.

Johnnsdottir, H.K., Johnnesdottir, G., Agnarsson, B.A., Eerola, H., Arason, A., Johnnsson, O.T., Heikkila, P., Egilesson, V., Olsson, H., Borg, A, et al. (2004). Deletions on chromosome 4 in sporadic and BRCA mutated tumors and association with pathological variables. Anticancer Research 24(5A), 2681-2687.

Kerangueven, F., Noguchi, T., Coulier, F., Alione, F., Wargniez, V., Simony-Lafontaine, J., Longy, M., Jacquemier, J., Sobol, H., Eisinger, F., et al. (1997). Genome-wide search for loss of heterozygosity shows extensive genetic diversity of human breast carcinomas. Cancer Res. 57, 5469-5474.

Kuller, L.H. (1995). The etiology of breast cancer from epidermiology to prevention. Public Health Rev. 23, 157-213.

Landegren, U., Kaiser, R., Caskey, C.T., and Hood, L. (1988). DNA diagnostics: Molecular techniques and automation. Science 242, 229-237.

Montagna, C., Andrechek, E.R., Padilla-Nash, H., Muller, W.J., and Reid, T. (2002). Centrosome abnormalities, recurring deletions of chromosome 4, and genomic amplification of HER2/neu define mouse mammary gland adenocarcinomas induced by mutant HER2/neu. Oncogene 21(6), 890-898.

O’Connell, P., Pekkel, V., Puqua, S.A. (1998). Analysis of loss of heterozygosity in 399-premalignant breast lesions at 15 genetic loci. J. Natl. Cancer 90, 697-703.

Osborne, C., Wilson, P., and Tripathy, D. (2004). Oncogenes and tumor suppressor genes in breast cancer: potential diagnostic and therapeutic applications. The Oncologist 9, 361-377.

Schwartz, L.M., Woloshin, S., Sox, H.C., Fischhoff, B., Welch, H.G. (2000). US women's attitudes to false positive mammography results and detection of ductal carcinoma in situ: cross sectional survey. BMJ 320, 1635-1640.

Shivapurkar, N., Sood, S., Wistuba, I.I., Virmani, A.K., Maitra, A., Milchgrub, S., Minna, J.D., and Gazdar, A.F. (1999). Multiple regions of chromosome 4 demonstrating allelic losses in breast carcinomas. Cancer Res. 59(15), 3576-3580.

Spencer, V.A., Samuel, S.K. and Davie, J.R. (2001). Altered profiles in nuclear matrix proteins associated with DNA in situ during progression of breast cancer cells. Cancer Res. 6, 1362-1366.

Waldman, F.M., DeVries, S., Chew, K.L. (2000). Chromosomal alterations in devoted carcinomas in situ and their in situ recurrences. J. Natl. Cancer 92, 313-320.

Watkins, P.C. (1988). Restriction Fragment Length Polymorphism (RFLP): application in human chromosome mapping and genetic disease research. Biotechniques 6, 310-320.

Wen, W.H., Bernstein, L., Lescallett, J., Beazer-Barclay, Y., Sullivan-Halley, J., White, M., and Press, M.F. (2000). Comparison of TP53 mutations identified by oligonucleotides microarray and conventional DNA sequence analysis. Cancer Res. 60, 2716-2722.

Williams, J.G.K., Kubelik, A.R., Livak, K.J. Rafalske, J.A., and Tingey, S.V. (1990). DNA polymorphism amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 18, 6531-6535.

Wood, K.V. (1990). Current status in bioluminescence and chemiluminescence. P. Stanley and L. Kricka, eds. (Chichester: John Wiley and Sons), pg. 543.

   
       
  Return to top.    
 
| Home | Contact UsEditorial Board | Current Issue | Submission |
 
 
 
© Copyright 2006, Scientific Journals International.  All Rights Reserved.